Stem-loop sequence ppy-mir-222

AccessionMI0014873 (change log)
DescriptionPongo pygmaeus miR-222 stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
   gcu           uaggua  c   au              -     auc   ucuu 
5'    gcuggaaggug      cc uca  ggcucaguagccag uguag   cug    u
      |||||||||||      || |||  |||||||||||||| |||||   |||    c
3'    cgaucuucuac      gg agu  cugggucaucgguc acauc   gac    g
   --u           ------  u   cu              u     gac   uaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chrX: 46471641-46471750 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-222
ppy-mir-222chrX: 46471641-46471750 [-]
ppy-mir-221chrX: 46470821-46470930 [-]
Database links

Mature sequence ppy-miR-222

Accession MIMAT0015808
Sequence

69 - 

agcuacaucuggcuacugggu

 - 89

Get sequence
Evidence not experimental

References

1