Stem-loop sequence ppy-mir-219-2

AccessionMI0014869 (change log)
DescriptionPongo pygmaeus miR-219-2 stem-loop
Gene family MIPF0000044; mir-219
Stem-loop
   a   a       c     u   u     aa           uac a  c 
5'  cuc ggggcuu gccac gau gucca  cgcaauucuug   g gu u
    ||| ||||||| ||||| ||| |||||  |||||||||||   | || g
3'  ggg ccucgag cggug cua caggu  guguuaagagc   c cg c
   -   -       u     u   -     cg           caa -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr9: 125361031-125361127 [-]
intergenic
Database links

Mature sequence ppy-miR-219-5p

Accession MIMAT0015804
Sequence

19 - 

ugauuguccaaacgcaauucu

 - 39

Get sequence
Evidence not experimental

References

1