Stem-loop sequence ppy-mir-217

AccessionMI0014868 (change log)
DescriptionPongo pygmaeus miR-217 stem-loop
Gene family MIPF0000077; mir-217
Stem-loop
   aguauaauuauuacaua    uu     c c  a  c     c          --   auaa 
5'                  guuu  gaugu g ag ua ugcau aggaacugau  ugg    g
                    ||||  ||||| | || || ||||| ||||||||||  |||    a
3'                  caaa  cuacg c uc gu acgua uccuugacua  acc    a
   --------------gaa    -u     a u  c  u     a          cc   gacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr2A: 55027671-55027780 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-217
ppy-mir-216achr2A: 55022400-55022509 [+]
ppy-mir-217chr2A: 55027671-55027780 [+]
Database links

Mature sequence ppy-miR-217

Accession MIMAT0015803
Sequence

35 - 

uacugcaucaggaacugauugga

 - 57

Get sequence
Evidence not experimental

References

1