Stem-loop sequence ppy-mir-216b

AccessionMI0014867 (change log)
DescriptionPongo pygmaeus miR-216b stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   --g       gaa         a  --caaa      g  ac 
5'    cagacug   aaucucugc gg      ugugau uc  u
      |||||||   ||||||||| ||      |||||| ||   
3'    gucugac   uuagagaug cc      acacua ag  g
   aca       auc         c  auucac      a  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr2A: 55007325-55007406 [+]
intergenic
Database links

Mature sequence ppy-miR-216b

Accession MIMAT0015802
Sequence

11 - 

aaaucucugcaggcaaauguga

 - 32

Get sequence
Evidence not experimental

References

1