Stem-loop sequence ppy-mir-210

AccessionMI0014866 (change log)
DescriptionPongo pygmaeus miR-210 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   accc   ca  -  -    c         gc     c   c c   c      -  --cg  gc 
5'     ggg  gu cu ccuc aggcgcagg  cagcc cug c cac gcacac ug    cu  c
       |||  || || |||| |||||||||  ||||| ||| | ||| |||||| ||    ||  c
3'     ccc  cg ga ggag uccgugucu  gucgg gac g gug cgugug ac    ga  c
   ----   ag  c  c    -         -a     c   a u   c      c  acca  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr11: 335370-335489 [-]
intergenic
Database links

Mature sequence ppy-miR-210

Accession MIMAT0015801
Sequence

75 - 

ugugccgugugacagcggcuga

 - 96

Get sequence
Evidence not experimental

References

1