Stem-loop sequence ppy-mir-208b

Accession MI0014865
Description Pongo pygmaeus miR-208b stem-loop
Gene family MIPF0000178; mir-208
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-208. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-208 is a family of microRNA precursors found in animals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. In humans, the gene for miR-208 is located in an intron of MYH7.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--c        g          c   aa        cu 
   cucucagg aagcuuuuug ucg  uuauguuu  g
   |||||||| |||||||||| |||  ||||||||  a
   gggagucu uuuggaaaac agc  aauauaag  u
gac        g          a   ag        cc 
Get sequence
Genome context
Coordinates (PPYG2) Overlapping transcripts
14: 22902043-22902119 [-]
intergenic

Mature sequence ppy-miR-208b

Accession MIMAT0015800
Sequence

46 - 

auaagacgaacaaaagguuugu

 - 67

Get sequence
Evidence not experimental

References

1