Stem-loop sequence ppy-mir-208b

AccessionMI0014865 (change log)
DescriptionPongo pygmaeus miR-208b stem-loop
Gene family MIPF0000178; mir-208
Stem-loop
   --c        g          c   aa        cu 
5'    cucucagg aagcuuuuug ucg  uuauguuu  g
      |||||||| |||||||||| |||  ||||||||  a
3'    gggagucu uuuggaaaac agc  aauauaag  u
   gac        g          a   ag        cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 22902043-22902119 [-]
intergenic
Database links

Mature sequence ppy-miR-208b

Accession MIMAT0015800
Sequence

46 - 

auaagacgaacaaaagguuugu

 - 67

Get sequence
Evidence not experimental

References

1