Stem-loop sequence ppy-mir-208a

AccessionMI0014864 (change log)
DescriptionPongo pygmaeus miR-208a stem-loop
Gene family MIPF0000178; mir-208
Stem-loop
   u   ag          g  c  gg      c  a 
5'  gac  gcgagcuuuu gc cg  uuauac ug u
    |||  |||||||||| || ||  |||||| || g
3'  cug  uguucgaaaa cg gc  aauaug ac c
   a   gu          a  a  ag      c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 22873225-22873295 [-]
intergenic
Database links

Mature sequence ppy-miR-208a

Accession MIMAT0015799
Sequence

44 - 

auaagacgagcaaaaagcuugu

 - 65

Get sequence
Evidence not experimental

References

1