Stem-loop sequence ppy-mir-205

AccessionMI0014863 (change log)
DescriptionPongo pygmaeus miR-205 stem-loop
Gene family MIPF0000058; mir-205
Stem-loop
   aaagaucc    acaa       gcuu      uc           c        ucuca 
5'         ucag    uccaugu    cucuug  cuucauuccac ggagucug     u
           ||||    |||||||    ||||||  ||||||||||| ||||||||     a
3'         aguc    agguacg    gaggac  gaagugaggug cuuuagac     c
   -------c    ---g       ----      uu           a        caacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 40697508-40697616 [-]
intergenic
Database links

Mature sequence ppy-miR-205

Accession MIMAT0015798
Sequence

34 - 

uccuucauuccaccggagucug

 - 55

Get sequence
Evidence not experimental

References

1