Stem-loop sequence ppy-mir-203

AccessionMI0014862 (change log)
DescriptionPongo pygmaeus miR-203 stem-loop
Gene family MIPF0000108; mir-203
Stem-loop
   g     gg acuc  g         c         u    g    a     - ug 
5'  uguug  g    gc cgcuggguc agugguucu aaca uuca caguu c  u
    |||||  |    || ||||||||| ||||||||| |||| |||| ||||| |   
3'  gcgac  c    cg gcggcccag ucaccagga uugu aagu guuaa g  a
   a     ag ggca  g         a         u    a    -     c cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 105835996-105836105 [+]
intergenic
Database links

Mature sequence ppy-miR-203

Accession MIMAT0015797
Sequence

65 - 

gugaaauguuuaggaccacuag

 - 86

Get sequence
Evidence not experimental

References

1