Stem-loop sequence ppy-mir-200a

AccessionMI0014861 (change log)
DescriptionPongo pygmaeus miR-200a stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   cc   - c   g        -            -----------     a 
5'   ggg c ccu ugagcauc uuaccggacagu           gcugg u
     ||| | ||| |||||||| ||||||||||||           ||||| u
3'   ccc g gga acuuguag aauggucuguca           cgacc u
   --   a u   a        c            caaucucaguu     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 229422413-229422500 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-200a
ppy-mir-200achr1: 229422413-229422500 [-]
ppy-mir-429chr1: 229421350-229421429 [-]
Database links

Mature sequence ppy-miR-200a

Accession MIMAT0015796
Sequence

54 - 

uaacacugucugguaacgaugu

 - 75

Get sequence
Evidence not experimental

References

1