Stem-loop sequence ppy-mir-199b

AccessionMI0014860 (change log)
DescriptionPongo pygmaeus miR-199b stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   cca    -acacc    cu  -     -  uu     uu   c  u    u  ----  a 
5'    gagg      ucca  cc gucua cc  ugugu  aga ua cugu ca    gg c
      ||||      ||||  || ||||| ||  |||||  ||| || |||| ||    ||  
3'    cucc      gggu  gg cggau gg  acacg  ucu au gaca gu    cc u
   -gg    cagauu    cg  u     u  uu     --   u  -    u  uaaa  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr9: 125179688-125179798 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-199b
ppy-mir-3154chr9: 125181208-125181319 [-]
ppy-mir-199bchr9: 125179688-125179798 [-]
Database links

Mature sequence ppy-miR-199b-5p

Accession MIMAT0015794
Sequence

31 - 

guguuuagacuaucuguuc

 - 49

Get sequence
Evidence not experimental

Mature sequence ppy-miR-199b-3p

Accession MIMAT0015795
Sequence

66 - 

acaguauucugcacauugguua

 - 87

Get sequence
Evidence not experimental

References

1