Dead miRNA entry

miRNA accession:
MI0014859
miRNA ID:
ppy-mir-199a-2
Forward to:
MI0002832
Comment:
The 2 annotated mir-199a sequences map to just 1 locus in the P_pygmaeus_2.0.2 genome assembly. The entries are rationalised and merged.

Previous miRNA entry

Stem-loop sequence ppy-mir-199a-2

AccessionMI0014859 (change log)
DescriptionPongo pygmaeus miR-199a-2 stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   aggaa   u  ggaga    -    c   gcc       u        c   --uca  ac 
5'      gcu cu     uccu gcuc guc   ccagugu cagacuac ugu     gg  a
        ||| ||     |||| |||| |||   ||||||| |||||||| |||     ||   
3'      cga ga     ggga cggg cag   gguuaca gucugaug aca     cc  a
   ----a   -  -----    a    u   auu       c        -   uguug  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ppy-miR-199a-5p

Accession MIMAT0015792
Sequence

31 - 

cccaguguucagacuaccuguuc

 - 53

Get sequence
Evidence not experimental

Mature sequence ppy-miR-199a-3p

Accession MIMAT0015793
Sequence

70 - 

acaguagucugcacauugguua

 - 91

Get sequence
Evidence not experimental

References

1