Stem-loop sequence ppy-mir-196b

AccessionMI0014858 (change log)
DescriptionPongo pygmaeus miR-196b stem-loop
Gene family MIPF0000031; mir-196
Stem-loop
   --     uc      uu       u  c           ucca 
5'   acugg  ggugau  agguagu uc uguuguuggga    c
     |||||  ||||||  ||||||| || |||||||||||     
3'   ugacu  ucauua  uccguca ag acgacagcucu    c
   gu     --      cu       c  c           cuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr7: 57281200-57281283 [+]
intergenic
Database links

Mature sequence ppy-miR-196b

Accession MIMAT0015791
Sequence

15 - 

uagguaguuuccuguuguuggg

 - 36

Get sequence
Evidence not experimental

References

1