Stem-loop sequence ppy-mir-195

AccessionMI0014857 (change log)
DescriptionPongo pygmaeus miR-195 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   a   u     g  cu          -a          caggga 
5'  gcu cccug cu  agcagcacag  aauauuggca      a
    ||| ||||| ||  ||||||||||  ||||||||||       
3'  ugg gggac ga  ucgucguguc  uuauaaccgu      g
   g   u     g  cc          gg          cugagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr17: 7022698-7022784 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-195
ppy-mir-497chr17: 7022994-7023105 [-]
ppy-mir-195chr17: 7022698-7022784 [-]
Database links

Mature sequence ppy-miR-195

Accession MIMAT0015790
Sequence

15 - 

uagcagcacagaaauauuggc

 - 35

Get sequence
Evidence not experimental

References

1