Stem-loop sequence ppy-mir-193b

AccessionMI0014856 (change log)
DescriptionPongo pygmaeus miR-193b stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
      gu       u    gu         g  a  ag uua 
5' gug  cucagaa cggg  uuugagggc ag ug  u   u
   |||  ||||||| ||||  ||||||||| || ||  |   g
3' uac  ggguuuu gccc  aaacucccg uc ac  a   u
      ug       c    ug         g  a  cu uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr16: 14771132-14771214 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-193b
ppy-mir-193bchr16: 14771132-14771214 [+]
ppy-mir-365-1chr16: 14777053-14777139 [+]
Database links

Mature sequence ppy-miR-193b

Accession MIMAT0015789
Sequence

51 - 

aacuggcccucaaagucccgcu

 - 72

Get sequence
Evidence not experimental

References

1