Stem-loop sequence ppy-mir-193a

AccessionMI0014855 (change log)
DescriptionPongo pygmaeus miR-193a stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
   cgaggau   a             u     cg   g  a   aggu 
5'        ggg gcugagggcuggg cuuug  ggc ag uga    g
          ||| ||||||||||||| |||||  ||| || |||     
3'        ccc cggcuccugaccc gaaac  ccg uc acu    u
   ------g   c             u     au   g  a   aggc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr17: 26401697-26401784 [+]
intergenic
Database links

Mature sequence ppy-miR-193a-5p

Accession MIMAT0015787
Sequence

21 - 

ugggucuuugcgggcgagauga

 - 42

Get sequence
Evidence not experimental

Mature sequence ppy-miR-193a-3p

Accession MIMAT0015788
Sequence

55 - 

aacuggccuacaaagucccagu

 - 76

Get sequence
Evidence not experimental

References

1