Stem-loop sequence ppy-mir-192

AccessionMI0014854 (change log)
DescriptionPongo pygmaeus miR-192 stem-loop
Gene family MIPF0000063; mir-192
Stem-loop
   gccgagacc   u  --   g g  c         -     a       ugcucuc 
5'          gag gc  aca g cu ugaccuaug aauug cagccag       g
            ||| ||  ||| | || ||||||||| ||||| |||||||        
3'          cuc cg  ugu u ga acuggauac uuaac gucgguc       u
   cgaccguaa   -  cu   a g  c         c     c       uccccuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr11: 11059354-11059463 [+]
intergenic
Database links

Mature sequence ppy-miR-192

Accession MIMAT0015786
Sequence

24 - 

cugaccuaugaauugacagcc

 - 44

Get sequence
Evidence not experimental

References

1