Stem-loop sequence ppy-mir-191

AccessionMI0014853 (change log)
DescriptionPongo pygmaeus miR-191 stem-loop
Gene family MIPF0000194; mir-191
Stem-loop
   c   u   c      ca         c  aa       uu  -  c 
5'  ggc gga agcggg  acggaaucc aa  gcagcug  gu cu c
    ||| ||| ||||||  ||||||||| ||  |||||||  || ||  
3'  ccg ccu ucgucc  ugcuuuagg uu  cgucgac  ua ga a
   u   u   c      cc         -  cg       cu  c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr3: 97473062-97473153 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-191
ppy-mir-191chr3: 97473062-97473153 [+]
ppy-mir-425chr3: 97473537-97473623 [+]
Database links

Mature sequence ppy-miR-191

Accession MIMAT0015785
Sequence

16 - 

caacggaaucccaaaagcagcug

 - 38

Get sequence
Evidence not experimental

References

1