Stem-loop sequence ppy-mir-190b

AccessionMI0014852 (change log)
DescriptionPongo pygmaeus miR-190b stem-loop
Gene family MIPF0000076; mir-190
Stem-loop
   -    u     -u               g     -   aa 
5'  ugcu cugug  gauauguuugauauu gguug uuu  u
    |||| |||||  ||||||||||||||| ||||| |||   
3'  acga gacau  uuauacaaacuguaa ucaac aag  u
   g    c     uc               a     c   ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 97310097-97310175 [+]
intergenic
Database links

Mature sequence ppy-miR-190b

Accession MIMAT0015784
Sequence

11 - 

ugauauguuugauauuggguu

 - 31

Get sequence
Evidence not experimental

References

1