Stem-loop sequence ppy-mir-190a

AccessionMI0014851 (change log)
Previous IDsppy-mir-190
DescriptionPongo pygmaeus miR-190 stem-loop
Gene family MIPF0000076; mir-190
Stem-loop
   u     c u    - ug               ua     uuau 
5'  gcagg c cugu g  auauguuugauauau  gguug    u
    ||||| | |||| |  |||||||||||||||  |||||     
3'  cguuc g gaca c  uauacaaacuauaua  ucaac    u
   c     u u    u cu               --     cuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr15: 59808517-59808601 [+]
intergenic
Database links

Mature sequence ppy-miR-190a

Accession MIMAT0015783
Previous IDsppy-miR-190
Sequence

15 - 

ugauauguuugauauauuaggu

 - 36

Get sequence
Evidence not experimental

References

1