Stem-loop sequence ppy-mir-186

AccessionMI0014850 (change log)
DescriptionPongo pygmaeus miR-186 stem-loop
Gene family MIPF0000109; mir-186
Stem-loop
   u     u                 u     u      ucuggu 
5'  gcuug aacuuuccaaagaauuc ccuuu gggcuu      u
    ||||| ||||||||||||||||| ||||| ||||||       
3'  cgagu uugaaggguuuuuuaag ggaaa cccgaa      u
   u     -                 u     -      uuuuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 158273689-158273774 [+]
intergenic
Database links

Mature sequence ppy-miR-186

Accession MIMAT0015782
Sequence

15 - 

caaagaauucuccuuuugggcu

 - 36

Get sequence
Evidence not experimental

References

1