Stem-loop sequence ppy-mir-185

AccessionMI0014849 (change log)
DescriptionPongo pygmaeus miR-185 stem-loop
Gene family MIPF0000202; mir-185
Stem-loop
   a     c       ug   a     g         au  uc 
5'  ggggg gagggau  gag gaaag caguuccug  gg  c
    ||||| |||||||  ||| ||||| |||||||||  ||   
3'  cccuc cuuccug  cuc cuuuc gucggggac  cc  c
   a     c       gu   -     g         -c  uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr22: 15919002-15919083 [+]
intergenic
Database links

Mature sequence ppy-miR-185

Accession MIMAT0015781
Sequence

15 - 

uggagagaaaggcaguuccuga

 - 36

Get sequence
Evidence not experimental

References

1