Stem-loop sequence ppy-mir-183

AccessionMI0014848 (change log)
DescriptionPongo pygmaeus miR-183 stem-loop
Gene family MIPF0000066; mir-183
Stem-loop
   cagag    ac  -----         g      --ac     ga        --   ac 
5'      cgug  uc     cuguucugu uauggc    uggua  auucacug  uga  a
        ||||  ||     ||||||||| ||||||    |||||  ||||||||  |||   
3'      gcac  ag     gacgagaca auaccg    gccau  uaagugac  acu  g
   ----a    cu  acaga         a      ggaa     --        ug   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr7: 126690908-126691014 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-183
ppy-mir-183chr7: 126690908-126691014 [-]
ppy-mir-96chr7: 126690695-126690772 [-]
ppy-mir-182chr7: 126686148-126686259 [-]
Database links

Mature sequence ppy-miR-183

Accession MIMAT0015780
Sequence

24 - 

uauggcacugguagaauucacu

 - 45

Get sequence
Evidence not experimental

References

1