Stem-loop sequence ppy-mir-181d

AccessionMI0014847 (change log)
DescriptionPongo pygmaeus miR-181d stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   -     --      -     ----aca   aa       auca         g ug          guga  a c 
5'  ucccc  uccccu aggcc       gcc  ggucaca    acauucauu u  ucgguggguu    gg c g
    |||||  |||||| |||||       |||  |||||||    ||||||||| |  ||||||||||    || |  
3'  agggg  agggga uucgg       cgg  ucggugu    uguaaguag g  ggccacccag    cc g a
   c     ua      a     cacagac   -g       -cac         g --          ---a  - g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr19: 13988344-13988479 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-181d
ppy-mir-181cchr19: 13988167-13988276 [+]
ppy-mir-181dchr19: 13988344-13988479 [+]
Database links

Mature sequence ppy-miR-181d

Accession MIMAT0015779
Sequence

35 - 

aacauucauuguugucggugggu

 - 57

Get sequence
Evidence not experimental

References

1