Stem-loop sequence ppy-mir-181c

AccessionMI0014846 (change log)
DescriptionPongo pygmaeus miR-181c stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   c   -aaauuug   ag     g    aa        cu       a     ggca 
5'  gga        cca  gguuu gggg  cauucaac  gucggug guuug    g
    |||        |||  ||||| ||||  ||||||||  ||||||| |||||    c
3'  ccu        ggu  ccaga uccc  gugaguug  cagcuac caaac    u
   u   accguuaa   --     g    ag        -c       -     ggac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr19: 13988167-13988276 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-181c
ppy-mir-181cchr19: 13988167-13988276 [+]
ppy-mir-181dchr19: 13988344-13988479 [+]
Database links

Mature sequence ppy-miR-181c

Accession MIMAT0015778
Sequence

27 - 

aacauucaaccugucggugagu

 - 48

Get sequence
Evidence not experimental

References

1