Stem-loop sequence ppy-mir-181b-2

AccessionMI0014845 (change log)
DescriptionPongo pygmaeus miR-181b-2 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   cuga   -     cucaa         cu           u  gu 
5'     ugg cugca     cauucauug  gucgguggguu ga  c
       ||| |||||     |||||||||  ||||||||||| ||  u
3'     acc ggcgu     guaaguagc  uagucacucaa cu  g
   acaa   a     caaac         --           -  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr9: 121589374-121589462 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-181b-2
ppy-mir-181a-2chr9: 121588113-121588222 [+]
ppy-mir-181b-2chr9: 121589374-121589462 [+]
Database links

Mature sequence ppy-miR-181b

Accession MIMAT0002628
Sequence

16 - 

aacauucauugcugucggugggu

 - 38

Get sequence
Evidence not experimental

References

1