Stem-loop sequence ppy-mir-181a-2

AccessionMI0014844 (change log)
DescriptionPongo pygmaeus miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   agaagggcuaucaggccagccuuca             a   u      cu       a    ggga 
5'                          gaggacuccaagg aca ucaacg  gucggug guuu    u
                            ||||||||||||| ||| ||||||  ||||||| ||||    u
3'                          uuccugggguucc ugu aguugc  cagucac caaa    u
   ------------------------a             a   c      --       -    aaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr9: 121588113-121588222 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-181a-2
ppy-mir-181a-2chr9: 121588113-121588222 [+]
ppy-mir-181b-2chr9: 121589374-121589462 [+]
Database links

Mature sequence ppy-miR-181a-5p

Accession MIMAT0002626
Previous IDsppy-miR-181a
Sequence

39 - 

aacauucaacgcugucggugagu

 - 61

Get sequence
Evidence not experimental

References

1