Stem-loop sequence ppy-mir-155

AccessionMI0014843 (change log)
DescriptionPongo pygmaeus miR-155 stem-loop
Gene family MIPF0000157; mir-155
Stem-loop
                u    a        uuuac 
5' cuguuaaugcuaa cgug uagggguu     c
   ||||||||||||| |||| ||||||||     u
3' gacaauuacgauu guac auccucag     c
                -    -        ucaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr21: 26044414-26044478 [+]
intergenic
Database links

Mature sequence ppy-miR-155

Accession MIMAT0015777
Sequence

4 - 

uuaaugcuaaucgugauaggggu

 - 26

Get sequence
Evidence not experimental

References

1