Stem-loop sequence ppy-mir-153-2

AccessionMI0014842 (change log)
DescriptionPongo pygmaeus miR-153-2 stem-loop
Gene family MIPF0000050; mir-153
Stem-loop
   a     gg      -             gu       -a  aa 
5'  gcggu  ccagug ucauuuuugugau  ugcagcu  gu  u
    |||||  |||||| |||||||||||||  |||||||  ||  a
3'  uguca  gguuac agugaaaacacug  acguuga  cg  u
   g     aa      u             au       cc  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr7: 155766898-155766984 [-]
intergenic
Database links

Mature sequence ppy-miR-153

Accession MIMAT0002272
Sequence

53 - 

uugcauagucacaaaagugauc

 - 74

Get sequence
Evidence not experimental

References

1