Stem-loop sequence ppy-mir-151a

AccessionMI0014841 (change log)
Previous IDsppy-mir-151
DescriptionPongo pygmaeus miR-151 stem-loop
Gene family MIPF0000057; mir-28
Stem-loop
   --------------u      c            ca          u ucu 
5'                uuccug ccucgaggagcu  cagucuagua g   c
                  |||||| ||||||||||||  |||||||||| |    
3'                agggac ggaguuccucga  gucagaucau c   a
   uccacucauacuggu      a            -a          c ccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr8: 148973588-148973676 [-]
intergenic
Database links

Mature sequence ppy-miR-151a-5p

Accession MIMAT0015775
Previous IDsppy-miR-151-5p
Sequence

11 - 

ucgaggagcucacagucuagu

 - 31

Get sequence
Evidence not experimental

Mature sequence ppy-miR-151a-3p

Accession MIMAT0015776
Previous IDsppy-miR-151-3p
Sequence

47 - 

cuagacugaagcuccuugagg

 - 67

Get sequence
Evidence not experimental

References

1