Stem-loop sequence ppy-mir-150

AccessionMI0014840 (change log)
DescriptionPongo pygmaeus miR-150 stem-loop
Gene family MIPF0000197; mir-150
Stem-loop
   c      u  -            ac   u       u -   g 
5'  ucccca gg cccugucuccca  ccu guaccag g cug g
    |||||| || ||||||||||||  ||| ||||||| | |||  
3'  aggggu cc gggacagggggu  gga caugguc c gac c
   c      -  a            cc   -       c a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr19: 51087615-51087698 [-]
intergenic
Database links

Mature sequence ppy-miR-150

Accession MIMAT0015774
Sequence

16 - 

ucucccaacccuuguaccagug

 - 37

Get sequence
Evidence not experimental

References

1