Stem-loop sequence ppy-mir-149

AccessionMI0014839 (change log)
DescriptionPongo pygmaeus miR-149 stem-loop
Gene family MIPF0000274; mir-149
Stem-loop
   gccggc    g   u u g      g     a     ---g  uu 
5'       gccc agc c g cuccgu ucuuc cuccc    ug  u
         |||| ||| | | |||||| ||||| |||||    ||   
3'       cggg ucg g c ggggca ggagg gaggg    ac  g
   ---cga    g   u u g      g     -     agga  cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr2B: 133208988-133209072 [+]
intergenic
Database links

Mature sequence ppy-miR-149

Accession MIMAT0015773
Sequence

15 - 

ucuggcuccgugucuucacuccc

 - 37

Get sequence
Evidence not experimental

References

1