Stem-loop sequence ppy-mir-148b

AccessionMI0014838 (change log)
DescriptionPongo pygmaeus miR-148b stem-loop
Gene family MIPF0000056; mir-148
Stem-loop
   caagcac  uu   a       ug         u  a    ca    gugg u 
5'        ga  agc uuugagg  aaguucugu au cacu  ggcu    c c
          ||  ||| |||||||  ||||||||| || ||||  ||||    | u
3'        cu  ucg aagcucu  uucaagaca ua guga  cuga    g c
   -----au  -u   a       gu         c  c    --    --aa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr12: 54119436-54119534 [+]
intergenic
Database links

Mature sequence ppy-miR-148b

Accession MIMAT0015772
Sequence

63 - 

ucagugcaucacagaacuuugu

 - 84

Get sequence
Evidence not experimental

References

1