Stem-loop sequence ppy-mir-148a

AccessionMI0014837 (change log)
DescriptionPongo pygmaeus miR-148a stem-loop
Gene family MIPF0000056; mir-148
Stem-loop
                 -  -a    cc    -   ag 
5' gaggcaaaguucug ag  cacu  gacu cug  u
   |||||||||||||| ||  ||||  |||| |||  a
3' cucuguuucaagac uc  guga  cuga gau  u
                 a  ac    --    a   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr7: 58508523-58508590 [+]
intergenic
Database links

Mature sequence ppy-miR-148a

Accession MIMAT0015771
Sequence

44 - 

ucagugcacuacagaacuuugu

 - 65

Get sequence
Evidence not experimental

References

1