Stem-loop sequence ppy-mir-147b

AccessionMI0014836 (change log)
DescriptionPongo pygmaeus miR-147b stem-loop
Gene family MIPF0000105; mir-147
Stem-loop
   --  u    c   ug   a            aacuagauu      
5'   ua aaau uag  gaa cauuucugcaca         cugga 
     || |||| |||  ||| ||||||||||||         |||| c
3'   au uuua auc  cuu guaaaggcgugu         gacca 
   gg  u    c   gu   c            ---------      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr15: 41874787-41874866 [+]
intergenic
Database links

Mature sequence ppy-miR-147b

Accession MIMAT0015770
Sequence

49 - 

gugugcggaaaugcuucugcua

 - 70

Get sequence
Evidence not experimental

References

1