Stem-loop sequence ppy-mir-146b

AccessionMI0014835 (change log)
DescriptionPongo pygmaeus miR-146b stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
     u      g        au        cu  ga  u 
5' cc ggcacu agaacuga  uccauagg  gu  gc c
   || |||||| ||||||||  ||||||||  ||  ||  
3' gg ccgugg ucuugacu  aggugucc  ua  cg u
     c      -        -c        cg  aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr10: 101489794-101489867 [+]
intergenic
Database links

Mature sequence ppy-miR-146b-5p

Accession MIMAT0015768
Sequence

9 - 

ugagaacugaauuccauaggcu

 - 30

Get sequence
Evidence not experimental

Mature sequence ppy-miR-146b-3p

Accession MIMAT0015769
Sequence

46 - 

ugcccuguggacucaguucugg

 - 67

Get sequence
Evidence not experimental

References

1