Stem-loop sequence ppy-mir-146a

AccessionMI0014834 (change log)
DescriptionPongo pygmaeus miR-146a stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   c     -----u      u     uu            c        g  uc 
5'  cgaug      guaucc cagcu  gagaacugaauu cauggguu ug  u
    |||||      |||||| |||||  |||||||||||| |||||||| ||  g
3'  gcugc      uauagg gucga  uucuugacuuaa guguccag ac  u
   u     ugucuc      -     -c            a        -  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr5: 162848366-162848464 [+]
intergenic
Database links

Mature sequence ppy-miR-146a

Accession MIMAT0015767
Sequence

21 - 

ugagaacugaauuccauggguu

 - 42

Get sequence
Evidence not experimental

References

1