Stem-loop sequence ppy-mir-140

AccessionMI0014832 (change log)
DescriptionPongo pygmaeus miR-140 stem-loop
Gene family MIPF0000085; mir-140
Stem-loop
   u       ucucu        -  a             a       uu   uc 
5'  gugucuc     guguccug cc gugguuuuacccu ugguagg  acg  a
    |||||||     |||||||| || ||||||||||||| |||||||  |||   
3'  cacgggg     cauaggac gg caccaagauggga accaucu  ugu  u
   c       ----c        a  -             c       --   cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr16: 57411201-57411300 [+]
intergenic
Database links

Mature sequence ppy-miR-140-5p

Accession MIMAT0015763
Sequence

23 - 

cagugguuuuacccuaugguag

 - 44

Get sequence
Evidence not experimental

Mature sequence ppy-miR-140-3p

Accession MIMAT0015764
Sequence

62 - 

uaccacaggguagaaccacgg

 - 82

Get sequence
Evidence not experimental

References

1