Stem-loop sequence ppy-mir-139

AccessionMI0014831 (change log)
DescriptionPongo pygmaeus miR-139 stem-loop
Gene family MIPF0000117; mir-139
Stem-loop
   gug       -   u  a            g gg 
5'    uauucua cag gc cgugucuccagu u  c
      ||||||| ||| || |||||||||||| |  u
3'    augaggu guc cg gcgcagaggucg a  c
   -ca       u   c  -            g gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr11: 67962511-67962578 [-]
intergenic
Database links

Mature sequence ppy-miR-139-5p

Accession MIMAT0015761
Sequence

7 - 

ucuacagugcacgugucuccag

 - 28

Get sequence
Evidence not experimental

Mature sequence ppy-miR-139-3p

Accession MIMAT0015762
Sequence

44 - 

ggagacgcggcccuguuggagu

 - 65

Get sequence
Evidence not experimental

References

1