Stem-loop sequence ppy-mir-138-2

AccessionMI0014830 (change log)
DescriptionPongo pygmaeus miR-138-2 stem-loop
Gene family MIPF0000075; mir-138
Stem-loop
   c u   u  ag             uca     -ac   c  cg 
5'  g ugc gc  cugguguugugaa   ggccg   gag ag  c
    | ||| ||  |||||||||||||   |||||   ||| ||   
3'  c acg ug  gaccacagcacuu   ucggc   uuc uc  a
   a u   u  -g             -ua     cca   -  cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr16: 44110836-44110919 [+]
intergenic
Database links

Mature sequence ppy-miR-138

Accession MIMAT0015760
Sequence

10 - 

agcugguguugugaaucaggccg

 - 32

Get sequence
Evidence not experimental

References

1