Stem-loop sequence ppy-mir-137

AccessionMI0014829 (change log)
DescriptionPongo pygmaeus miR-137 stem-loop
Gene family MIPF0000106; mir-137
Stem-loop
   g u  u   --           ug   g           ug a     -  g 
5'  g cc cug  acucucuucgg  acg guauucuuggg  g uaaua cg a
    | || |||  |||||||||||  ||| |||||||||||  | ||||| || u
3'  c gg gac  ugagaggagcu  ugc cauaagaauuc  u auugu gc u
   a -  c   ca           ga   g           gu -     u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 130594384-130594485 [+]
intergenic
Database links

Mature sequence ppy-miR-137

Accession MIMAT0015759
Sequence

59 - 

uuauugcuuaagaauacgcguag

 - 81

Get sequence
Evidence not experimental

References

1