Stem-loop sequence ppy-mir-135b

AccessionMI0014828 (change log)
DescriptionPongo pygmaeus miR-135b stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   -------ca    -                   cau          --   cu 
5'          cucu gcuguggccuauggcuuuu   uccuauguga  uug  g
            |||| |||||||||||||||||||   ||||||||||  |||   
3'          ggga ugacaucggguaccgaaaa   gggauguacu  aac  u
   ccucgaacg    g                   -uc          ca   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 44744545-44744641 [+]
intergenic
Database links

Mature sequence ppy-miR-135b

Accession MIMAT0015758
Sequence

16 - 

uauggcuuuucauuccuauguga

 - 38

Get sequence
Evidence not experimental

References

1