Stem-loop sequence ppy-mir-135a-1

AccessionMI0014827 (change log)
DescriptionPongo pygmaeus miR-135a-1 stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   a g         u u          uu            uucua 
5'  g ccucgcugu c cuauggcuuu  auuccuauguga     c
    | ||||||||| | ||||||||||  ||||||||||||     u
3'  c ggggcggca g ggugccgagg  uagggauauacu     g
   a a         c c          -u            cacuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr3: 94055868-94055957 [+]
intergenic
Database links

Mature sequence ppy-miR-135a

Accession MIMAT0015757
Sequence

17 - 

uauggcuuuuuauuccuauguga

 - 39

Get sequence
Evidence not experimental

References

1