Stem-loop sequence ppy-mir-133b

AccessionMI0014826 (change log)
DescriptionPongo pygmaeus miR-133b stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
   ----ccucagaagaaaga    --       c        ca  c  a      u  g      
5'                   ugcc  cccugcu uggcuggu  aa gg accaag cc ucuuc 
                     ||||  ||||||| ||||||||  || || |||||| || |||| c
3'                   acgg  gggacga aucgacca  uu cc ugguuu gg agagu 
   agagguucaugaaccgua    uc       c        ac  c  c      -  -      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr6: 52486818-52486936 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-133b
ppy-mir-206chr6: 52482243-52482328 [+]
ppy-mir-133bchr6: 52486818-52486936 [+]
Database links

Mature sequence ppy-miR-133b

Accession MIMAT0015756
Sequence

66 - 

uuugguccccuucaaccagcua

 - 87

Get sequence
Evidence not experimental

References

1