Stem-loop sequence ppy-mir-133c

AccessionMI0014825 (change log)
DescriptionPongo pygmaeus miR-133c stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
   g  a    --     uuu    g       aa  u  a        g cug 
5'  gg gcca  aaugc   gcua agcuggu  aa gg accaaauc a   u
    || ||||  |||||   |||| |||||||  || || |||||||| |    
3'  cc cggu  uuacg   cgau ucgacca  uu cc ugguuuag u   c
   g  g    ag     ugu    g       ac  c  c        g aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr20: 60896506-60896607 [+]
intergenic
NW_002968278.1: 5369-5470 [+]
intergenic
Database links

Mature sequence ppy-miR-133c

Accession MIMAT0016973
Sequence

59 - 

uuugguccccuucaaccagcug

 - 80

Get sequence
Evidence not experimental

References

1