Stem-loop sequence ppy-mir-132

AccessionMI0014824 (change log)
DescriptionPongo pygmaeus miR-132 stem-loop
Gene family MIPF0000065; mir-132
Stem-loop
   c   cccc    -  c a    a         uuc          --gu g 
5'  cgc    gcgu cu c gggc accguggcu   gauuguuacu    g g
    |||    |||| || | |||| |||||||||   ||||||||||    |  
3'  gcg    cgca ga g cccg ugguaccga   cugacaaugg    c a
   c   cacc    c  c c    c         cau          aggu a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr17: 1926594-1926694 [-]
intergenic
Database links

Mature sequence ppy-miR-132

Accession MIMAT0015755
Sequence

59 - 

uaacagucuacagccauggucg

 - 80

Get sequence
Evidence not experimental

References

1