Stem-loop sequence ppy-mir-130b

AccessionMI0014823 (change log)
DescriptionPongo pygmaeus miR-130b stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
         c    ca       cc         a  auggg  g 
5' ggccug ccga  cucuuuc  uguugcacu cu     cc c
   |||||| ||||  |||||||  ||||||||| ||     ||  
3' cuggac ggcu  gggaaag  guaacguga ga     gg u
         u    ac       ua         c  ----a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr22: 16950667-16950748 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-130b
ppy-mir-301bchr22: 16950346-16950423 [+]
ppy-mir-130bchr22: 16950667-16950748 [+]
Database links

Mature sequence ppy-miR-130b

Accession MIMAT0015754
Sequence

51 - 

cagugcaaugaugaaagggcau

 - 72

Get sequence
Evidence not experimental

References

1