Stem-loop sequence ppy-mir-130a

AccessionMI0014822 (change log)
DescriptionPongo pygmaeus miR-130a stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   u     -       a        c      ug  a   ucu  a 
5'  gcugc uggccag gcucuuuu acauug  cu cug   gc c
    ||||| ||||||| |||||||| ||||||  || |||   ||  
3'  ugaug gccgguu cgggaaaa uguaac  ga gau   ug c
   g     u       a        u      gu  c   cac  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr11: 19239577-19239665 [-]
intergenic
Database links

Mature sequence ppy-miR-130a

Accession MIMAT0015753
Sequence

55 - 

cagugcaauguuaaaagggcau

 - 76

Get sequence
Evidence not experimental

References

1