Stem-loop sequence ppy-mir-129-2

AccessionMI0014821 (change log)
DescriptionPongo pygmaeus miR-129-2 stem-loop
Gene family MIPF0000073; mir-129
Stem-loop
   u             -       c   cu      ---     acau 
5'  gcccuucgcgaau cuuuuug ggu  gggcuu   gcugu    a
    ||||||||||||| ||||||| |||  ||||||   |||||     
3'  cgggaggcguuua gaaaaac cca  cccgaa   cgaua    a
   g             c       c   uu      ggc     acuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr11: 25179740-25179829 [-]
intergenic
Database links

Mature sequence ppy-miR-129-5p

Accession MIMAT0015751
Previous IDsppy-miR-129
Sequence

15 - 

cuuuuugcggucugggcuugc

 - 35

Get sequence
Evidence not experimental

Mature sequence ppy-miR-129-2-3p

Accession MIMAT0016972
Previous IDsppy-miR-129-2*
Sequence

57 - 

aagcccuuaccccaaaaagcau

 - 78

Get sequence
Evidence not experimental

References

1