Stem-loop sequence ppy-mir-129-1

AccessionMI0014820 (change log)
DescriptionPongo pygmaeus miR-129-1 stem-loop
Gene family MIPF0000073; mir-129
Stem-loop
       -       c   cu      g   uu cu  c 
5' ggau cuuuuug ggu  gggcuu cug  c  cu a
   |||| ||||||| |||  |||||| |||  |  ||  
3' ucua gaaaaac cca  cccgaa gac  g  ga a
       u       c   uu      g   -u au  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr7: 125265618-125265689 [+]
intergenic
Database links

Mature sequence ppy-miR-129-5p

Accession MIMAT0015751
Previous IDsppy-miR-129
Sequence

5 - 

cuuuuugcggucugggcuugc

 - 25

Get sequence
Evidence not experimental

Mature sequence ppy-miR-129-1-3p

Accession MIMAT0015752
Previous IDsppy-miR-129-1*
Sequence

49 - 

aagcccuuaccccaaaaaguau

 - 70

Get sequence
Evidence not experimental

References

1