miRNA Entry for MI0014820

The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours.

Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages:

You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages.

Please note, we're not responsible for the content of Wikipedia pages.

You can read more about miRBase, Wikipedia and community annotation on this blog post.

Please email us for help or with comments about this community annotation initiative.

The miR-129 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. This microRNA was first experimentally characterised in mouse and homologues have since been discovered in several other species, such as humans, rats and zebrafish. The mature sequence is excised by the Dicer enzyme from the 5' arm of the hairpin. It was elucidated by Calin et al. that miR-129-1 is located in a fragile site region of the human genome near a specific site, FRA7H in chromosome 7q32, which is a site commonly deleted in many cancers. miR-129-2 is located in 11p11.2.

mir-129 microRNA precursor family

Predicted secondary structure and sequence conservation of mir-129
Identifiers
Symbol	mir-129
Rfam	RF00486
miRBase	MI0000252
miRBase family	MIPF0000073
Other data
RNA type	Gene; miRNA
Domain(s)	Eukaryota
GO	0035195 0035068
SO	0001244

The miR-129 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. This microRNA was first experimentally characterised in mouse^[1] and homologues have since been discovered in several other species, such as humans,^[2] rats^[3] and zebrafish.^[4] The mature sequence is excised by the Dicer enzyme from the 5' arm of the hairpin. It was elucidated by Calin et al. that miR-129-1 is located in a fragile site region of the human genome near a specific site, FRA7H in chromosome 7q32, which is a site commonly deleted in many cancers. miR-129-2 is located in 11p11.2.^[5]

1 Expression Patterns
2 Targets of miR-129
3 Clinical Relevance of miR-129
- 3.1 Biomarkers for Diagnostics
4 References
5 Further reading
6 External links

[edit] Expression Patterns

miR-129 seems to have a tissue specific expression pattern localised to the brain in normal humans. This finding was identified initially by microarray experimentation with mouse tissue (and more specifically to the cerebellum)^[1] which was subsequently validated by the expression profiling in human tissue. However, expression in normal brain tissue was found to be relatively low and different profiling experimentation methodologies produced differing results. These differences and the low levels of detection may be attributed to the size and complexity of the human brain and the fact that specific regions of the brain were not individually tested.^[6]

[edit] Targets of miR-129

[edit] Cdk4

As with many other microRNAs, the expression profile of miR-129 changes with the onset of cancer. In many different tumour cell lines, such as gastric cancer, medulloblastoma and endometrial cancer, lung andeocarcinoma and colorectal carcinoma, there are lower levels of miR-129 indicating that it may play a role in the suppression of cell growth. There is evidence to suggest that miR-129 directly targets Cdk4, cyclin dependant kinase 4- a cell proliferation regulator. This is due to the effects of the down regulation of miR-129 in cancer cells resulting in their proliferation. Conversely in the over expression of miR-129, proliferation of endometrial tumour cells is significantly reduced via the down regulation of Cdk4.^[7]

[edit] SOX4

SOX4, SRY-related HMG box 4 gene – an oncogene that is known to be deregulated in a number of cancers, is another target of miR-129 in which the aberrant regulation of miR-129 contributes to the proliferation of cancer cell lines. SOX4 is involved in the mediation of transcription response to Wnt signalling. In endometrial cancers and gastric cancers, there has been a clear link established between the epigenetic repression, or loss, of miR-129 and the over-expression of SOX4. In experiments where miR-129 levels were returned to normal in cancer cells, SOX4 expression was down regulated. Further, it has been suggested that promoter hypermethylation of miR-129-2 is the main contributor of SOX4 over expression in some types of cancer.^[8]^[9]

[edit] GALNT1

GALNT1, N-acetylgalactosaminyltransferase 1 – involved in TGF-β signalling, is another target of miR-129 that was identified by luciferase assay. It was observed that when cancer cells were subjected to transfection with the precursor of miR-129, GALNT1 was subsequently down regulated by the direct targeting of miR-129. The SOX4 target observation was also validated in this study. These results correlate with the notion that high levels of miR-129 and low SOX4 and GALNT1 levels correlate to cancer cell progression.^[10]

[edit] APC and Rab11

Adenomatous polyposis coli (APC), a tumour suppressor gene controlled by Wnt signalling and involved in proliferation, and Rab11 have also been identified as miR-129 targets from a RT-PCR experiment of the expression profiles of human esophageal squamous cell carcinoma (ESCC) . This study shows the over expression of miR-129 may play a part in the development of ESCC. This may be due to the possible suppression of signal transduction pathways via APC and Rab11.^[11]

[edit] EIF2C3 and CAMTA1

miR-129 may also play a role in hematopoietic stem cell development. It has been shown that miR-129 may participate in a stem cell developmental network with EIF2C3 (eukaryotic translation initiation factor 2C, 3) and CAMTA1 (calmodulin binding transcription activator 1) with the induction of cell differentiation. It is postulated that miR-129 may affect differentiation and the cell cycle regulation^[12] by inhibiting CAMTA1 translation.^[13]

[edit] Clinical Relevance of miR-129

[edit] Biomarkers for Diagnostics

MicroRNAs have given cancer researchers a new perspective to understand and combat cancer. This is due to them being produced in a tissue-specific manner and their roles in many aspects of cellular process, such as proliferation and apoptosis. The vast amount of experimental data has enabled the specific microRNA signatures and profiles to be recognised and thus used as potential biomarkers in cancer diagnosis, therapy prediction and prognosis.

miR-129 has been identified as a potential candidate for development into a diagnostic biomarker. This is because of its integral role it plays in the proliferation of cells and its many recognisable, statistically significant and independent interactions with its targets as observed by the expression profiles in the study carried out by Ogawa et al..^[11]

[edit] References

^ ^a ^b Lagos-Quintana, M; Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T (2002). "Identification of tissue-specific microRNAs from mouse". Curr Biol 12 (9): 735–739. doi:10.1016/S0960-9822(02)00809-6. PMID 12007417.
^ Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T (2003). "New microRNAs from mouse and human". RNA 9 (2): 175–9. doi:10.1261/rna.2146903. PMC 1370382. PMID 12554859. //www.ncbi.nlm.nih.gov/pmc/articles/PMC1370382/.
^ He X, Zhang Q, Liu Y, Pan X (2007). "Cloning and identification of novel microRNAs from rat hippocampus". Acta Biochim Biophys Sin (Shanghai) 39 (9): 708–14. doi:10.1111/j.1745-7270.2007.00324.x. PMID 17805466.
^ Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J et al. (2005). "The developmental miRNA profiles of zebrafish as determined by small RNA cloning". Genes Dev 19 (11): 1288–93. doi:10.1101/gad.1310605. PMC 1142552. PMID 15937218. //www.ncbi.nlm.nih.gov/pmc/articles/PMC1142552/.
^ Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, Yendamuri S et al. (2004). "Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers". Proc Natl Acad Sci U S A 101 (9): 2999–3004. doi:10.1073/pnas.0307323101. PMC 365734. PMID 14973191. //www.ncbi.nlm.nih.gov/pmc/articles/PMC365734/.
^ Barad O, Meiri E, Avniel A, Aharonov R, Barzilai A, Bentwich I et al. (2004). "MicroRNA expression detected by oligonucleotide microarrays: System establishment and expression profiling in human tissues". Genome Res 14 (12): 2486–94. doi:10.1101/gr.2845604. PMC 534673. PMID 15574827. //www.ncbi.nlm.nih.gov/pmc/articles/PMC534673/.
^ Wu J, Qian J, Li C, Kwok L, Cheng F, Liu P et al. (2010). "miR-129 regulates cell proliferation by downregulating Cdk6 expression". Cell Cycle 9 (9): 1809–18. doi:10.4161/cc.9.9.11535. PMID 20404570.
^ Shen R, Pan S, Qi S, Lin X, Cheng S (2010). "Epigenetic repression of microRNA-129-2 leads to overexpression of SOX4 in gastric cancer". Biochem Biophys Res Commun 394 (4): 1047–52. doi:10.1016/j.bbrc.2010.03.121. PMID 20331975.
^ Huang YW, Liu JC, Deatherage DE, Luo J, Mutch DG, Goodfellow PJ et al. (2009). "Epigenetic Repression of microRNA-129-2 Leads to Overexpression of SOX4 Oncogene in Endometrial Cancer". Cancer Res 69 (23): 9038–46. doi:10.1158/0008-5472.CAN-09-1499. PMC 2789184. PMID 19887623. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2789184/.
^ Dyrskjøt L, Ostenfeld MS, Bramsen JB, Silahtaroglu AN, Lamy P, Ramanathan R et al. (2009). "Genomic profiling of microRNAs in bladder cancer: miR-129 is associated with poor outcome and promotes cell death in vitro". Cancer Res 69 (11): 4851–60. doi:10.1158/0008-5472.CAN-08-4043. PMID 19487295.
^ ^a ^b Ogawa R, Ishiguro H, Kuwabara Y, Kimura M, Mitsui A, Katada T et al. (2009). "Expression profiling of micro-RNAs in human esophageal squamous cell carcinoma using RT-PCR". Med Mol Morphol 42 (2): 102–9. doi:10.1007/s00795-009-0443-1. PMID 19536617.
^ Nakatani K, Nishioka J, Itakura T, Nakanishi Y, Horinouchi J, Abe Y et al. (2004). "Cell cycle-dependent transcriptional regulation of calmodulin-binding transcription activator 1 in neuroblastoma cells". Int J Oncol 24 (6): 1407–12. PMID 15138581.
^ Liao R, Sun J, Zhang L, Lou G, Chen M, Zhou D et al. (2008). "MicroRNAs play a role in the development of human hematopoietic stem cells". J Cell Biochem 104 (3): 805–17. doi:10.1002/jcb.21668. PMID 18189265.

[edit] Further reading

Lagos-Quintana, M; Rauhut R, Meyer J, Borkhardt A, Tuschl T (2003). "New microRNAs from mouse and human". RNA 9 (2): 175–179. doi:10.1261/rna.2146903. PMC 1370382. PMID 12554859. //www.ncbi.nlm.nih.gov/pmc/articles/PMC1370382/.
Wu J, Qian J, Li C, et al. (May 2010). "miR-129 regulates cell proliferation by downregulating Cdk6 expression". Cell Cycle 9 (9): 1809–18. doi:10.4161/cc.9.9.11535. PMID 20404570.
Dyrskjøt L, Ostenfeld MS, Bramsen JB, et al. (June 2009). "Genomic profiling of microRNAs in bladder cancer: miR-129 is associated with poor outcome and promotes cell death in vitro". Cancer Res. 69 (11): 4851–60. doi:10.1158/0008-5472.CAN-08-4043. PMID 19487295.
Shen R, Pan S, Qi S, Lin X, Cheng S (April 2010). "Epigenetic repression of microRNA-129-2 leads to overexpression of SOX4 in gastric cancer". Biochem. Biophys. Res. Commun. 394 (4): 1047–52. doi:10.1016/j.bbrc.2010.03.121. PMID 20331975.
Huang YW, Liu JC, Deatherage DE, et al. (December 2009). "Epigenetic Repression of microRNA-129-2 Leads to Overexpression of SOX4 Oncogene in Endometrial Cancer". Cancer Res. 69 (23): 9038–46. doi:10.1158/0008-5472.CAN-09-1499. PMC 2789184. PMID 19887623. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2789184/.
Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ (2006). "miRBase: microRNA sequences, targets and gene nomenclature". Nucleic Acids Res 34 (Database issue): D140–4. doi:10.1093/nar/gkj112. PMC 1347474. PMID 16381832. //www.ncbi.nlm.nih.gov/pmc/articles/PMC1347474/.
Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP (2003). "Vertebrate microRNA genes". Science 299 (5612): 1540. doi:10.1126/science.1080372. PMID 12624257.

[edit] External links

v t e miRNA precursor families

1-100	1 2 6 7 8/141/200 9/79 10 15 16 17 19 21 22 24 26 29 30 31 33 34 46/47/281 92 96

101-200	101 103/107 122 124 126 127 129 130 132 133 134 135 137 138 143 144 145 146 148/152 150 155 156 160 166 172 181 184 191 192/215 194 196 199 200

201+	203 205 208 210 214 218 219 221 223 224 296 338 395 399 433 451

Other	BART1 BART2 BHRF1-1 BHRF1-2 BHRF1-3 Let-7 Lin-4 Lsy-6

Mature sequence ppy-miR-129-5p
Accession	MIMAT0015751
Previous IDs	ppy-miR-129
Sequence	5 - cuuuuugcggucugggcuugc - 25 Get sequence
Evidence	not experimental

Mature sequence ppy-miR-129-1-3p
Accession	MIMAT0015752
Previous IDs	ppy-miR-129-1*
Sequence	49 - aagcccuuaccccaaaaaguau - 70 Get sequence
Evidence	not experimental

miRBase

Stem-loop sequence ppy-mir-129-1

Contents